zgc:153444

Ensembl ID:
ENSDARG00000087059
ZFIN ID:
ZDB-GENE-060929-88
Description:
hypothetical protein LOC767744 [Source:RefSeq peptide;Acc:NP_001070181]
Human Orthologue:
C10orf58
Human Description:
chromosome 10 open reading frame 58 [Source:HGNC Symbol;Acc:28651]
Mouse Orthologue:
5730469M10Rik
Mouse Description:
RIKEN cDNA 5730469M10 gene Gene [Source:MGI Symbol;Acc:MGI:1917814]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22178 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22178
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115742 Nonsense 24 143 3 6
Genomic Location (Zv9):
Chromosome 12 (position 49033369)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 47909871
GRCz11 12 47780585
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCTCTCCTCTCTGAAGGCTCAGTTGGATGAGTGTGGAGTGTGTCTGTA[T/A]GCGGTGGTCAAAGAGAACGTCGGCTCAGAGATTCAGCTCTTCAGGCTGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link