zgc:101598

Ensembl ID:
ENSDARG00000087058
ZFIN ID:
ZDB-GENE-041121-12
Description:
far upstream element-binding protein 3 [Source:RefSeq peptide;Acc:NP_001007777]
Human Orthologue:
FUBP3
Human Description:
far upstream element (FUSE) binding protein 3 [Source:HGNC Symbol;Acc:4005]
Mouse Orthologue:
Fubp3
Mouse Description:
far upstream element (FUSE) binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:2443699]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33517 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33517
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026923   None 310 None 9
ENSDART00000123339 Essential Splice Site 178 359 5 15
Genomic Location (Zv9):
Chromosome 5 (position 1314098)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 871500
GRCz11 5 907467
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCAATAATCCCTTGCGGGATGCTGGATTATTAGACTATAAGGCACAGC[T/G]GAGGTGTATTATTTTCTAATAGTTCAACAGCTTGTCGTTTGTTATTCCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Height: Identification of ten loci associated with height highlights new biological pathways in human growth. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link