
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
URB1 (2 of 2)
- Ensembl ID:
- ENSDARG00000087043
- Description:
- URB1 ribosome biogenesis 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:17344]
- Human Orthologue:
- URB1
- Human Description:
- URB1 ribosome biogenesis 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:17344]
- Mouse Orthologue:
- Urb1
- Mouse Description:
- URB1 ribosome biogenesis 1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2146468]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa10519 | Nonsense | Available for shipment | Available now |
sa42481 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa10519
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000063468 | Nonsense | 44 | 1605 | 1 | 31 |
- Genomic Location (Zv9):
- Chromosome 15 (position 5614266)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 5732603 GRCz11 15 5720454 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGTTTAGTGGCACTGTTTTTAAATCYATGCTRAAGGATTCATCTGAAGCA[C/T]AGAAGGGTGAGTATTCTATCAAATCTTACWGTTSAAAACATMATTTATTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42481
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000063468 | Essential Splice Site | 692 | 1605 | 16 | 31 |
- Genomic Location (Zv9):
- Chromosome 15 (position 5590144)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 5708262 GRCz11 15 5696113 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GACGTTGGGTCTGTCCCAGCAGGAGACCGTCATACAGTTTCTAGACCATG[T/C]ACTGGATTTTGACCACTTGCATATGGTTTTACTGGGCATTTGTCATTTTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: