cubn

Ensembl ID:
ENSDARG00000087013
ZFIN ID:
ZDB-GENE-060228-6
Description:
Cubn protein [Source:UniProtKB/TrEMBL;Acc:B0JZN9]
Human Orthologue:
CDCP2
Human Description:
CUB domain containing protein 2 [Source:HGNC Symbol;Acc:27297]
Mouse Orthologue:
Cdcp2
Mouse Description:
CUB domain containing protein 2 Gene [Source:MGI Symbol;Acc:MGI:3045328]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37922 Nonsense Available for shipment Available now
sa45836 Essential Splice Site Mutation detected in F1 DNA During 2018
sa25216 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37922
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124198 Nonsense 135 420 3 8
Genomic Location (Zv9):
Chromosome 24 (position 33279953)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 32159854
GRCz11 24 32074497
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTGTTGGGGAAACACTGTGGAAACAACCTTCCGGCTCCCATGGATACT[G/T]GAGACAGTTTTGCCTATGTAAAGTTTGTCAGTGATGCTAGCGCGAATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45836
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124198 Essential Splice Site 224 420 4 8
Genomic Location (Zv9):
Chromosome 24 (position 33279527)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 32159428
GRCz11 24 32074071
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACTTGAGGCTGGAGGACCAAAGTACCTGCGCATTTGACTTTGTTGAG[G/A]TGAGGTTATCTGTATGTTTTAAAGGGGGTCATCCTGTTAAATACTTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25216
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124198 Essential Splice Site 224 420 4 8
Genomic Location (Zv9):
Chromosome 24 (position 33279526)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 32159427
GRCz11 24 32074070
KASP Assay ID:
554-7676.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACTTGAGGCTGGAGGACCAAAGTACCTGCGCATTTGACTTTGTTGAGG[T/C]GAGGTTATCTGTATGTTTTAAAGGGGGTCATCCTGTTAAATACTTTCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link