wu:fc26g07

Ensembl ID:
ENSDARG00000086988
ZFIN ID:
ZDB-GENE-030131-3087

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9238 Nonsense Mutation detected in F1 DNA During 2018
sa42409 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9238
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127645 Nonsense 230 954 1 7
Genomic Location (Zv9):
Chromosome 14 (position 31773597)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 30563654
GRCz11 14 30903968
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAYTCGAAAGAACAACCTGATACTGGTGAAATTAAGACTGTAGAGYTG[C/T]AAAACATCAAGGAGAAGAACAGYACCTTCGATTTCCCCAAAGACTCGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42409
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127645 Nonsense 634 954 1 7
Genomic Location (Zv9):
Chromosome 14 (position 31772385)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 30562442
GRCz11 14 30902756
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATGAAAACAAACTTCATGTTTACATCCACACCTATAGTTTTTGGCAAA[G/T]AGTCCAGATTTGAAATACTCAGAGATACAAAGCCCACCCCTATGAGAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link