
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ATXN1L
- Ensembl ID:
- ENSDARG00000086977
- Description:
- ataxin 1-like [Source:HGNC Symbol;Acc:33279]
- Human Orthologue:
- ATXN1L
- Human Description:
- ataxin 1-like [Source:HGNC Symbol;Acc:33279]
- Mouse Orthologue:
- Atxn1l
- Mouse Description:
- ataxin 1-like Gene [Source:MGI Symbol;Acc:MGI:3694797]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa21147 | Essential Splice Site | Available for shipment | Available now |
sa21146 | Essential Splice Site | Available for shipment | Available now |
sa45303 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa21147
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000127351 | Essential Splice Site | 299 | 651 | 2 | 6 |
ENSDART00000130304 | Essential Splice Site | 302 | 678 | 2 | 5 |
- Genomic Location (Zv9):
- Chromosome 7 (position 72139594)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 69185441 GRCz11 7 69422763 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGGGAGAATGTCTCCTGGACAGAGCAGCACACCTGACACTGATCTCGAG[G/A]TAGGCTTATGTCAAGATCAGATTTTTTCATTGTGATTGTCAACCTCAGTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21146
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000127351 | Essential Splice Site | 416 | 651 | 5 | 6 |
ENSDART00000130304 | None | 678 | None | 5 |
- Genomic Location (Zv9):
- Chromosome 7 (position 72133074)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 69178921 GRCz11 7 69416243 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCAACAGGGTCAGCAGGTGATTTCTGCCCCAGCTCCTGGTGCTTTTCCAC[A/T]AGCTCCTCTGCTAGCACCCACCGGCCCATCGCACTTCATGAAGGGCGCCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45303
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000127351 | Essential Splice Site | 587 | 651 | 5 | 6 |
ENSDART00000130304 | None | 678 | None | 5 |
- Genomic Location (Zv9):
- Chromosome 7 (position 72132557)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 69178404 GRCz11 7 69415726 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCTCAGCCTATGGGCCCCCCTGCACCCCAGCACACACCTCGACCACAAAG[T/C]CACTTAAAGATCCACAGAGAGAGGGAACATAACAAGGAAGAGCCCATGCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: