
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000086969
- Ensembl ID:
- ENSDARG00000086969
- Human Orthologues:
- PCDHB1, PCDHG@, PCDHGA1, PCDHGA10, PCDHGA11, PCDHGA12, PCDHGA3, PCDHGA5, PCDHGA6, PCDHGA7, PCDHGA8
- Human Descriptions:
- protocadherin beta 1 [Source:HGNC Symbol;Acc:8680]
- protocadherin gamma cluster [Source:HGNC Symbol;Acc:8695]
- protocadherin gamma subfamily A, 1 [Source:HGNC Symbol;Acc:8696]
- protocadherin gamma subfamily A, 10 [Source:HGNC Symbol;Acc:8697]
- protocadherin gamma subfamily A, 11 [Source:HGNC Symbol;Acc:8698]
- protocadherin gamma subfamily A, 12 [Source:HGNC Symbol;Acc:8699]
- protocadherin gamma subfamily A, 3 [Source:HGNC Symbol;Acc:8701]
- protocadherin gamma subfamily A, 5 [Source:HGNC Symbol;Acc:8703]
- protocadherin gamma subfamily A, 6 [Source:HGNC Symbol;Acc:8704]
- protocadherin gamma subfamily A, 7 [Source:HGNC Symbol;Acc:8705]
- protocadherin gamma subfamily A, 8 [Source:HGNC Symbol;Acc:8706]
- Mouse Orthologue:
- Pcdhb1
- Mouse Description:
- protocadherin beta 1 Gene [Source:MGI Symbol;Acc:MGI:2136730]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa27597 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa27598 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa27599 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa38796 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa27597
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000128215 | Nonsense | 99 | 782 | 1 | 2 |
- Genomic Location (Zv9):
- Chromosome 10 (position 21966181)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 21796709 GRCz11 10 21754090 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCTGCAGTGTAAGTTTTGATGTGATTTTGGAGAATCCGATGGAGCTTTAT[C/T]GAGTAACAGTTGACATACAAGACATCAATGACAACAGCCCCGTCTTTCCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa27598
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000128215 | Nonsense | 149 | 782 | 1 | 2 |
- Genomic Location (Zv9):
- Chromosome 10 (position 21966331)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 21796859 GRCz11 10 21754240 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GATTTCCATTAGAGAGCGCGGTAGATCCAGACGTGGGAGTGAACGCGCTA[C/T]AAAAATACACTCTTCAACCCACCGACCATTTTAAGCTTAATGTTCAGAGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa27599
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000128215 | Nonsense | 457 | 782 | 1 | 2 |
- Genomic Location (Zv9):
- Chromosome 10 (position 21967255)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 21797783 GRCz11 10 21755164 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTATAGCTGAAAATAACCCACCATCTACGACTATTCTGACTGTCAAAGCA[G/T]AAGACATGGACTGGGGGCCGAATGCAAAGGTCTCATACTTTCTTATCGAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38796
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000128215 | Nonsense | 750 | 782 | 1 | 2 |
- Genomic Location (Zv9):
- Chromosome 10 (position 21968136)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 21798664 GRCz11 10 21756045 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTGGGACCACAGACTCAAGGATGAGTGACGTAAAGTTTGTCAGGCCCTA[C/A]AGTCAGAACACACTGGTCAGCCAGAGTCGTTTGGGGACAGTTCAGAGAGA
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: