si:dkey-267j14.4

Ensembl ID:
ENSDARG00000086933
ZFIN ID:
ZDB-GENE-081104-399
Human Orthologue:
TNNI3K
Human Description:
TNNI3 interacting kinase [Source:HGNC Symbol;Acc:19661]
Mouse Orthologue:
Tnni3k
Mouse Description:
TNNI3 interacting kinase Gene [Source:MGI Symbol;Acc:MGI:2443276]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41170 Essential Splice Site Mutation detected in F1 DNA During 2018
sa34364 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41170
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129148 Essential Splice Site 556 835 16 25
Genomic Location (Zv9):
Chromosome 8 (position 18487600)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17932488
GRCz11 8 17968200
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATACGTTTCTGGAGGATCCCTGTTCTCGCTACTGCACGAACAAAAGAGG[T/A]CATTTCAAGAGTATTATTACAATGAATGTATTAAAACACATTAATACTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34364
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129148 Nonsense 702 835 21 25
Genomic Location (Zv9):
Chromosome 8 (position 18482110)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17926998
GRCz11 8 17962710
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTGGATACTCAATCCCCAAACCCATCTCAGCACTGCTCATGAGGGGCT[G/A]GAACGTTTGTCCAGAGGTCAGTGGGCCACATCTACCTGAAAATATAACAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)
  • Pubertal anthropometrics: Genome-wide association and longitudinal analyses reveal genetic loci linking pubertal height growth, pubertal timing and childhood adiposity. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link