stambpb

Ensembl ID:
ENSDARG00000086906
ZFIN ID:
ZDB-GENE-051127-31
Description:
STAM binding protein [Source:RefSeq peptide;Acc:NP_001032659]
Human Orthologue:
STAMBP
Human Description:
STAM binding protein [Source:HGNC Symbol;Acc:16950]
Mouse Orthologue:
Stambp
Mouse Description:
STAM binding protein Gene [Source:MGI Symbol;Acc:MGI:1917777]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34521 Nonsense Mutation detected in F1 DNA During 2018
sa21399 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34521
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127729 Nonsense 147 418 5 10
Genomic Location (Zv9):
Chromosome 8 (position 55102514)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 52551521
GRCz11 8 52537814
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCTGTGGAGCGCGAGCTGTCCCGTCAGCGTGAGCTGGATGCGGAGCGT[C/T]GACGTGTGGCAGAGCTGCAGAGGAGACAGCAGGAGCAGGAGCAGTTCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21399
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127729 Nonsense 305 418 7 10
Genomic Location (Zv9):
Chromosome 8 (position 55099587)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 52554448
GRCz11 8 52540741
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGTGACACACGTGGTGGTCCCGAAGCAGTGTGGAGGTCCAGATTACTG[T/A]GACACAGAGAACGAAGAGGAGCTGTTTCTGGTGCAGGACCAGTACAACCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link