si:dkey-7i4.1

Ensembl ID:
ENSDARG00000086897
ZFIN ID:
ZDB-GENE-081028-64

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22562 Nonsense Available for shipment Available now
sa32007 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22562
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123282 Nonsense 350 1096 4 10
ENSDART00000136137 Nonsense 275 492 1 1
Genomic Location (Zv9):
Chromosome 15 (position 795677)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 835980
GRCz11 15 796783
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCAGGCCTCCAAAATCCTCTCCCATATTAAGACATCTCGCAGTCTCTA[C/A]ATCATGTGCCACATTCCTGTGTTCTGCTGGATCACGGCCACCGTTCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32007
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123282 Nonsense 958 1096 10 10
ENSDART00000136137   None 492 None 1
Genomic Location (Zv9):
Chromosome 15 (position 803504)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 843807
GRCz11 15 804610
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTCCGAGGAGAACAGAAAGGTGACGTGTGTGAGAAAGAAACAGCCGTA[T/A]CCAGATCATCCAGACAGATTTGAGGGATATCTGCAGGTGCTGTGCAGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link