zgc:154055

Ensembl ID:
ENSDARG00000086885
ZFIN ID:
ZDB-GENE-060929-612
Description:
hypothetical protein LOC556036 [Source:RefSeq peptide;Acc:NP_001070610]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32153 Essential Splice Site Available for shipment Available now
sa36418 Nonsense Mutation detected in F1 DNA During 2018
sa28859 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32153
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130339 Essential Splice Site 151 568 4 11
Genomic Location (Zv9):
Chromosome 17 (position 25243823)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25383742
GRCz11 17 25402133
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGGGGTTGTCCTCAACAGAGCAATATTACAAGCAAACAGAAAGGCTGG[T/C]GAGCTGCGTTTTTCTCTCTTTCACTTTCTGTTCCCTTTCCTTCAGTTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36418
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130339 Nonsense 253 568 6 11
Genomic Location (Zv9):
Chromosome 17 (position 25246646)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25386565
GRCz11 17 25404956
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATTGATGGGTCAGAGATGGGTTACATCATTGATCTGCGCTCTGCCCAA[C/T]AAGCCCAGCAGGCCCGGATGACAGGAGGAGGTTTTGAGTCCAAATCCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28859
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130339 Nonsense 504 568 10 11
Genomic Location (Zv9):
Chromosome 17 (position 25253441)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25393360
GRCz11 17 25411751
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGAACCCACAGATCTGGCCATTTGGCCTTCAGTTCATCCTCAGTCCTTA[C/T]AGCTGTGGACAGGTCAGTAAGTACACACAGAAATGCACATTTCTGAAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link