
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
NP_919406.1
- Ensembl ID:
- ENSDARG00000086877
- Description:
- major histocompatibility complex class I ZE [Source:RefSeq peptide;Acc:NP_919406]
- Human Orthologues:
- AL645933.1, AZGP1, FCGRT, HFE, MICB, MR1
- Human Descriptions:
- alpha-2-glycoprotein 1, zinc-binding [Source:HGNC Symbol;Acc:910]
- Fc fragment of IgG, receptor, transporter, alpha [Source:HGNC Symbol;Acc:3621]
- hemochromatosis [Source:HGNC Symbol;Acc:4886]
- major histocompatibility complex, class I-related [Source:HGNC Symbol;Acc:4975]
- MHC class I polypeptide-related sequence A isoform 2 (MICA*00801) precursor [Source:RefSeq peptide;
- MHC class I polypeptide-related sequence B [Source:HGNC Symbol;Acc:7091]
- Mouse Orthologues:
- Azgp1, CR974466.3, Fcgrt, Gm11127, Gm7030, Gm8815, Gm8909, H2-Bl, H2-D1, H2-gs10, H2-K1, H2-K2, H2-M2, H2-M3, H2-Q10, H2-Q2, H2-Q6, H2-Q7, H2-Q8, H2-T10, H2-T22, H2-T23, H2-T3, Hfe, Mill1, Mill2, Mr1
- Mouse Descriptions:
- alpha-2-glycoprotein 1, zinc Gene [Source:MGI Symbol;Acc:MGI:103163]
- Fc receptor, IgG, alpha chain transporter Gene [Source:MGI Symbol;Acc:MGI:103017]
- hemochromatosis Gene [Source:MGI Symbol;Acc:MGI:109191]
- histocompatibility 2, blastocyst Gene [Source:MGI Symbol;Acc:MGI:892004]
- histocompatibility 2, D region locus 1 Gene [Source:MGI Symbol;Acc:MGI:95896]
- histocompatibility 2, K region locus 2 Pseudogene [Source:MGI Symbol;Acc:MGI:95906]
- histocompatibility 2, K1, K region Gene [Source:MGI Symbol;Acc:MGI:95904]
- histocompatibility 2, M region locus 2 Gene [Source:MGI Symbol;Acc:MGI:95914]
- histocompatibility 2, M region locus 3 Gene [Source:MGI Symbol;Acc:MGI:95915]
- histocompatibility 2, Q region locus 10 Gene [Source:MGI Symbol;Acc:MGI:95929]
- histocompatibility 2, Q region locus 2 [Source:RefSeq peptide;Acc:NP_034522]
- histocompatibility 2, Q region locus 2 Gene [Source:MGI Symbol;Acc:MGI:95931]
- histocompatibility 2, Q region locus 6 Gene [Source:MGI Symbol;Acc:MGI:95935]
- histocompatibility 2, Q region locus 7 Gene [Source:MGI Symbol;Acc:MGI:95936]
- histocompatibility 2, Q region locus 8 Gene [Source:MGI Symbol;Acc:MGI:95937]
- histocompatibility 2, T region locus 10 Gene [Source:MGI Symbol;Acc:MGI:95942]
- histocompatibility 2, T region locus 22 Gene [Source:MGI Symbol;Acc:MGI:95956]
- histocompatibility 2, T region locus 23 Gene [Source:MGI Symbol;Acc:MGI:95957]
- histocompatibility 2, T region locus 3 Gene [Source:MGI Symbol;Acc:MGI:95959]
- major histocompatibility complex, class I-related Gene [Source:MGI Symbol;Acc:MGI:1195463]
- MHC class I like protein GS10 Gene [Source:MGI Symbol;Acc:MGI:3808875]
- MHC I like leukocyte 1 Gene [Source:MGI Symbol;Acc:MGI:2179988]
- MHC I like leukocyte 2 Gene [Source:MGI Symbol;Acc:MGI:2179989]
- predicted gene 11127 Gene [Source:MGI Symbol;Acc:MGI:3779381]
- predicted gene 7030 Pseudogene [Source:MGI Symbol;Acc:MGI:3647514]
- predicted gene 8815 Pseudogene [Source:MGI Symbol;Acc:MGI:3648635]
- predicted gene 8909 Gene [Source:MGI Symbol;Acc:MGI:3704134]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa19562 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa19562
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000039465 | Essential Splice Site | 308 | 337 | 4 | 5 |
- Genomic Location (Zv9):
- Chromosome 1 (position 47627084)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 46438745 GRCz11 1 47129977 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTTATGTGAAGCACAGAACCCTTGGAGCACCAATTATCAAAAAATGGGG[T/C]AATCAAAGCATACAGATTCAAAAAGCATGACAAAACCTGGGAACTTACAA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- AIDS progression: Genomewide association study of an AIDS-nonprogression cohort emphasizes the role played by HLA genes (ANRS Genomewide Association Study 02). (View Study)
- Alcohol consumption: Genome-wide association study identifies two loci strongly affecting transferrin glycosylation. (View Study)
- Behcet's disease: Identification of a susceptibility locus in STAT4 for Behçet's disease in Han Chinese in a genome-wide association study. (View Study)
- Blood pressure: Genome-wide association study identifies six new loci influencing pulse pressure and mean arterial pressure. (View Study)
- Cardiovascular disease risk factors: Genetic variants in LPL, OASL and TOMM40/APOE-C1-C2-C4 genes are associated with multiple cardiovascular-related traits. (View Study)
- Dengue shock syndrome : Genome-wide association study identifies susceptibility loci for dengue shock syndrome at MICB and PLCE1. (View Study)
- Glycated hemoglobin levels: Common variants at 10 genomic loci influence hemoglobin A₁(C) levels via glycemic and nonglycemic pathways. (View Study)
- Hematology traits: Sequence variants in three loci influence monocyte counts and erythrocyte volume. (View Study)
- Hemoglobin: Genome-wide association study identifies variants in TMPRSS6 associated with hemoglobin levels. (View Study)
- Hepcidin levels: Association of HFE and TMPRSS6 genetic variants with iron and erythrocyte parameters is only in part dependent on serum hepcidin concentrations. (View Study)
- Hodgkin's lymphoma: Genome-wide association study of classical Hodgkin lymphoma and Epstein-Barr virus status-defined subgroups. (View Study)
- Iron levels: Identification of a common variant in the TFR2 gene implicated in the physiological regulation of serum iron levels. (View Study)
- Iron status biomarkers: Common variants in TMPRSS6 are associated with iron status and erythrocyte volume. (View Study)
- Iron status biomarkers: Genome-wide association study identifies genetic loci associated with iron deficiency. (View Study)
- Iron status biomarkers: Novel association to the proprotein convertase PCSK7 gene locus revealed by analysing soluble transferrin receptor (sTfR) levels. (View Study)
- Iron status biomarkers: Variants in TF and HFE explain approximately 40% of genetic variation in serum-transferrin levels. (View Study)
- Mean platelet volume: A genome-wide meta-analysis identifies 22 loci associated with eight hematological parameters in the HaemGen consortium. (View Study)
- Metabolic syndrome: Genome-wide screen for metabolic syndrome susceptibility Loci reveals strong lipid gene contribution but no evidence for common genetic basis for clustering of metabolic syndrome traits. (View Study)
- Other erythrocyte phenotypes: Multiple loci influence erythrocyte phenotypes in the CHARGE Consortium. (View Study)
- Platelet counts: GWAS of blood cell traits identifies novel associated loci and epistatic interactions in Caucasian and African-American children. (View Study)
- Pulmonary function: Genome-wide association and large-scale follow up identifies 16 new loci influencing lung function. (View Study)
- Red blood cell traits: A genome-wide association study of red blood cell traits using the electronic medical record. (View Study)
- Red blood cell traits: Genome-wide association analysis of red blood cell traits in African Americans: the COGENT Network. (View Study)
- Red blood cell traits: Seventy-five genetic loci influencing the human red blood cell. (View Study)
- Serum total protein level: Discovery and fine mapping of serum protein loci through transethnic meta-analysis. (View Study)
- Systolic blood pressure: Genetic variants in novel pathways influence blood pressure and cardiovascular disease risk. (View Study)
- Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)
- Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: