slc12a2

Ensembl ID:
ENSDARG00000086870
ZFIN ID:
ZDB-GENE-040625-53
Human Orthologue:
SLC12A2
Human Description:
solute carrier family 12 (sodium/potassium/chloride transporters), member 2 [Source:HGNC Symbol;Acc:
Mouse Orthologue:
Slc12a2
Mouse Description:
solute carrier family 12, member 2 Gene [Source:MGI Symbol;Acc:MGI:101924]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21694 Nonsense Available for shipment Available now
sa31771 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21694
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129844 Nonsense 151 271 1 4
Genomic Location (Zv9):
Chromosome 10 (position 16254900)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16268207
GRCz11 10 16226326
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTTCGGACACAACACCATCGACGCCGTGCCCAAGATCGACTTCTACCGG[C/T]AGACCGCCGCTCCGCTGGGCGAGAAACTCATTAGACCCACCCTCTCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31771
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129844 Nonsense 243 271 4 4
Genomic Location (Zv9):
Chromosome 10 (position 16292813)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16306120
GRCz11 10 16264239
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTCTCACATTTTGTCATCTCACATTTTTATTTCCACAGCATATTCCTG[T/A]ATCATTGTTATTATGGCAACTGTTGTGACAACCATCACAGGCTGCTCGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link