atad3b

Ensembl ID:
ENSDARG00000086848
ZFIN ID:
ZDB-GENE-040426-1826
Description:
ATPase family AAA domain-containing protein 3 [Source:RefSeq peptide;Acc:NP_991266]
Human Orthologues:
ATAD3A, ATAD3B, ATAD3C
Human Descriptions:
ATPase family, AAA domain containing 3A [Source:HGNC Symbol;Acc:25567]
ATPase family, AAA domain containing 3B [Source:HGNC Symbol;Acc:24007]
ATPase family, AAA domain containing 3C [Source:HGNC Symbol;Acc:32151]
Mouse Orthologue:
Atad3a
Mouse Description:
ATPase family, AAA domain containing 3A Gene [Source:MGI Symbol;Acc:MGI:1919214]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43734 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43734
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127829 Nonsense 179 221 6 6
Genomic Location (Zv9):
Chromosome 22 (position 47564)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 56582
GRCz11 22 5284
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTTACAGCCACCATTGAGCACGAGATGGACCTGCGGCACAAGAAC[G/T]AGATGCTGCGCGTGGAGGCGGAGTCTAAAGCTCGCGCGCGTGTGGAGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link