si:dkey-27b3.7

Ensembl ID:
ENSDARG00000086838
ZFIN ID:
ZDB-GENE-091204-176
Human Orthologue:
ITGA2
Human Description:
integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) [Source:HGNC Symbol;Acc:6137]
Mouse Orthologue:
Itga2
Mouse Description:
integrin alpha 2 Gene [Source:MGI Symbol;Acc:MGI:96600]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38778 Essential Splice Site Mutation detected in F1 DNA During 2018
sa8378 Essential Splice Site Mutation detected in F1 DNA During 2018
sa21668 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38778
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122223 Essential Splice Site 132 674 3 18
ENSDART00000141045   None 276 None 8

The following transcripts of ENSDARG00000086838 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 8953250)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9029206
GRCz11 10 8862765
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCATCCCTGATATTTCAGTCGGAGGTGAAGGGAAGGTAGTGCAGCTCTG[G/A]TGAGAGTCTTGTGTTGCTATTTAACTGGATATACTTCCTTACTTACTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8378
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122223 Essential Splice Site 186 674 None 18
ENSDART00000141045   None 276 None 8

The following transcripts of ENSDARG00000086838 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 8954756)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9030712
GRCz11 10 8864271
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGTTTGYTTCAGGTCCACATTTAGACCCWMAGGTTTGGKTAAAGTAGG[T/A]AAGCCTATCWCTRGTGAGTTTTATATCTCCCGTATGTTCAAAAATCCCMG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21668
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122223 Essential Splice Site 464 674 None 18
ENSDART00000141045 Essential Splice Site 66 276 None 8

The following transcripts of ENSDARG00000086838 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 8968041)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9043997
GRCz11 10 8877556
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTATCAAATTTTGATGACATCGGCCGAGAGTTCAACATAACGTTAAGAG[T/A]GAGTCCAAAAATGTATATTTATTATTTCTATACATGAACATGTCTGAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link