
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
NP_001103184.1
- Ensembl ID:
- ENSDARG00000086810
- Description:
- DNA mismatch repair protein Msh3 [Source:RefSeq peptide;Acc:NP_001103184]
- Human Orthologue:
- MSH3
- Human Description:
- mutS homolog 3 (E. coli) [Source:HGNC Symbol;Acc:7326]
- Mouse Orthologue:
- Msh3
- Mouse Description:
- mutS homolog 3 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:109519]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa20529 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa20529
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000130210 | Nonsense | 1064 | 1083 | 23 | 23 |
ENSDART00000140414 | None | 131 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 5 (position 53307394)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 50788984 GRCz11 5 51435577 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGGCTCTCGTGAACAGCCGGAGGTACGTGGGCAGATTGGTTACACAATG[G/A]AAGAAGAACACTGTAGTAATTTTGTATTGTGGAGGAACTTCGTTCAGAAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: