zgc:112042

Ensembl ID:
ENSDARG00000086786
ZFIN ID:
ZDB-GENE-050417-154
Description:
major facilitator superfamily domain-containing protein 10 [Source:RefSeq peptide;Acc:NP_001017667]
Human Orthologue:
MFSD10
Human Description:
major facilitator superfamily domain containing 10 [Source:HGNC Symbol;Acc:16894]
Mouse Orthologue:
Mfsd10
Mouse Description:
major facilitator superfamily domain containing 10 Gene [Source:MGI Symbol;Acc:MGI:1915544]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33757 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33757
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129903 Nonsense 388 450 12 13
Genomic Location (Zv9):
Chromosome 5 (position 69221977)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 65555242
GRCz11 5 66234347
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTGTGAATGTATGACTGTGTTACTGATGTCTGTATTGGTTTGTAGGCT[C/A]AGCCAGTCAGAAAGGAACAGTAATGGGAATCCTTCGTAGTCTTGGAGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link