im:7163673

Ensembl ID:
ENSDARG00000086764
ZFIN ID:
ZDB-GENE-060810-185
Human Orthologue:
MDC1
Human Description:
mediator of DNA-damage checkpoint 1 [Source:HGNC Symbol;Acc:21163]
Mouse Orthologue:
Mdc1
Mouse Description:
mediator of DNA damage checkpoint 1 Gene [Source:MGI Symbol;Acc:MGI:3525201]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4640 Nonsense F2 line generated During 2018
sa36050 Nonsense Mutation detected in F1 DNA During 2018
sa6411 Nonsense Mutation detected in F1 DNA During 2018
sa36051 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa4640
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121966 Nonsense 55 1914 2 9
Genomic Location (Zv9):
Chromosome 16 (position 11950175)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 10442344
GRCz11 16 10333246
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTYCTTTACTCAAATTTCAGAATTTCCTCTCTATGTCGGAGAAAATATCT[T/A]GGGTCGGGATCCTGCTGCCTGTTCTGTTCTGCTTCCGGCCCGATCTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36050
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121966 Nonsense 685 1914 4 9
Genomic Location (Zv9):
Chromosome 16 (position 11955529)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 10447698
GRCz11 16 10338600
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACACAAGCTTTTGGCCACCTTGAAGATGACTGGGACTTTATACCCACA[C/T]AAGCATATGGTAACATCCCACTCACTTTGAGTCTATTTATCTCATTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6411
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121966 Nonsense 1436 1914 5 9
Genomic Location (Zv9):
Chromosome 16 (position 11958307)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 10450476
GRCz11 16 10341378
KASP Assay ID:
554-5171.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGAGAAGAGAAGGAAAGGTTGGAGARGAAGAGAAACGAGCAAGAAGAW[C/T]AAAGACAAAAAGAGGAGGAARGAATTCAAAGAGAKAAGGAACAAAAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36051
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121966 Nonsense 1647 1914 5 9
Genomic Location (Zv9):
Chromosome 16 (position 11958940)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 10451109
GRCz11 16 10342011
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGCAGGGGGAGAAGAGGCAGGACTTCTGGTGTGGAAAATGTAGACGTC[G/T]GAATGAGCAATGAGCTTAAACAAGATGCGAAGATGGTTGAAGACAATACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link