
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
im:7163673
- Ensembl ID:
- ENSDARG00000086764
- ZFIN ID:
- ZDB-GENE-060810-185
- Human Orthologue:
- MDC1
- Human Description:
- mediator of DNA-damage checkpoint 1 [Source:HGNC Symbol;Acc:21163]
- Mouse Orthologue:
- Mdc1
- Mouse Description:
- mediator of DNA damage checkpoint 1 Gene [Source:MGI Symbol;Acc:MGI:3525201]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa4640 | Nonsense | F2 line generated | During 2018 |
sa36050 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa6411 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa36051 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa4640
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000121966 | Nonsense | 55 | 1914 | 2 | 9 |
- Genomic Location (Zv9):
- Chromosome 16 (position 11950175)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 10442344 GRCz11 16 10333246 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTYCTTTACTCAAATTTCAGAATTTCCTCTCTATGTCGGAGAAAATATCT[T/A]GGGTCGGGATCCTGCTGCCTGTTCTGTTCTGCTTCCGGCCCGATCTGTGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36050
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000121966 | Nonsense | 685 | 1914 | 4 | 9 |
- Genomic Location (Zv9):
- Chromosome 16 (position 11955529)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 10447698 GRCz11 16 10338600 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAACACAAGCTTTTGGCCACCTTGAAGATGACTGGGACTTTATACCCACA[C/T]AAGCATATGGTAACATCCCACTCACTTTGAGTCTATTTATCTCATTCTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6411
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000121966 | Nonsense | 1436 | 1914 | 5 | 9 |
- Genomic Location (Zv9):
- Chromosome 16 (position 11958307)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 10450476 GRCz11 16 10341378 - KASP Assay ID:
- 554-5171.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAAGAGAAGAGAAGGAAAGGTTGGAGARGAAGAGAAACGAGCAAGAAGAW[C/T]AAAGACAAAAAGAGGAGGAARGAATTCAAAGAGAKAAGGAACAAAAAGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36051
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000121966 | Nonsense | 1647 | 1914 | 5 | 9 |
- Genomic Location (Zv9):
- Chromosome 16 (position 11958940)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 10451109 GRCz11 16 10342011 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGGCAGGGGGAGAAGAGGCAGGACTTCTGGTGTGGAAAATGTAGACGTC[G/T]GAATGAGCAATGAGCTTAAACAAGATGCGAAGATGGTTGAAGACAATACT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: