
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
im:7145391
- Ensembl ID:
- ENSDARG00000086747
- ZFIN IDs:
- ZDB-GENE-030131-8820, ZDB-GENE-041111-237
- Description:
- Toll-interacting protein [Source:UniProtKB/Swiss-Prot;Acc:Q7ZV43]
- Human Orthologue:
- TOLLIP
- Human Description:
- toll interacting protein [Source:HGNC Symbol;Acc:16476]
- Mouse Orthologue:
- Tollip
- Mouse Description:
- toll interacting protein Gene [Source:MGI Symbol;Acc:MGI:1891808]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12341 | Nonsense | Available for shipment | Available now |
sa7111 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa21153 | Nonsense | Available for shipment | Available now |
sa968 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa12341
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000126917 | Nonsense | 116 | 276 | 3 | 6 |
- Genomic Location (Zv9):
- Chromosome 7 (position 74852239)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 72034601 GRCz11 7 72283892 - KASP Assay ID:
- 554-4500.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGGAACAAAGTCATCCAGTGCACYGTCCCTCCCGGGGTGGACTCCTTCTA[T/A]CTGGAGATATTCGATGAGGTCAGACTTCAATAMTCAATATAHAGACYTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa7111
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000126917 | Nonsense | 116 | 276 | 3 | 6 |
- Genomic Location (Zv9):
- Chromosome 7 (position 74852239)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 72034601 GRCz11 7 72283892 - KASP Assay ID:
- 554-4500.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGGAACAAAGTCATCCAGTGCACCGTCCCTCCCGGGGTGGACTCCTTCTA[T/A]CTGGAGATATTCGATGAGGTCAGACTTCAATAMTCAATATATAGACYTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21153
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000126917 | Nonsense | 152 | 276 | 4 | 6 |
ENSDART00000126917 | Nonsense | 152 | 276 | 4 | 6 |
- Genomic Location (Zv9):
- Chromosome 7 (position 74854945)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 72037307 GRCz11 7 72286598 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTCACAATCCCTGAAAACCTGCGGGAGGGAACTGTAGTGGACGAGTGGTA[C/A]AGCCTGAGCGGGAGACAGGGGGACGACAAAGAGGGCATGATTAATCTCGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa968
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000126917 | Nonsense | 152 | 276 | 4 | 6 |
ENSDART00000126917 | Nonsense | 152 | 276 | 4 | 6 |
- Genomic Location (Zv9):
- Chromosome 7 (position 74854945)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 72037307 GRCz11 7 72286598 - KASP Assay ID:
- 554-0873.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTCACAATCCCTGAAAACCTGCGGGAGGGAACTGTAGTGGACGAGTGGTA[C/G]AGCCTGAGCRGGAGACAGGGGGACGACAAAGAGGGCATGATTAATCTCGT
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: