A8KC49_DANRE

Ensembl ID:
ENSDARG00000086744
Description:
LOC100149217 protein [Source:UniProtKB/TrEMBL;Acc:A8KC49]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29686 Nonsense Mutation detected in F1 DNA During 2018
sa32365 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa29686
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121703 Nonsense 50 408 4 4
ENSDART00000128295 Nonsense 50 418 1 2
Genomic Location (Zv9):
Chromosome 22 (position 1429156)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2170246
GRCz11 22 2186512
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCAATACAATCTCAAGCATCACATGATGATCCACACGAGCTTCAATTG[T/A]TCAGAAAACCTGAATATTTATGAGAGGATCCACAGTGGAGAGAAAACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32365
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121703 Nonsense 293 408 4 4
ENSDART00000128295 Nonsense 293 418 1 2
Genomic Location (Zv9):
Chromosome 22 (position 1429885)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2170975
GRCz11 22 2187241
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTTGAAAAAGCACCAGAAGATCCACACTGGAGAGAAACCGCATGTGTG[T/A]TCACACTGCAACAAGAGATTTACTACTTTAGGACAGCTGAAAGTACATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link