
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
F13B
- Ensembl ID:
- ENSDARG00000086724
- Description:
- coagulation factor XIII, B polypeptide [Source:HGNC Symbol;Acc:3534]
- Human Orthologue:
- F13B
- Human Description:
- coagulation factor XIII, B polypeptide [Source:HGNC Symbol;Acc:3534]
- Mouse Orthologue:
- F13b
- Mouse Description:
- coagulation factor XIII, beta subunit Gene [Source:MGI Symbol;Acc:MGI:88379]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa40784 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa40784
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000128700 | Nonsense | 93 | 359 | 3 | 12 |
- Genomic Location (Zv9):
- Chromosome 6 (position 47445332)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 47506075 GRCz11 6 47504959 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACATTATGTTTGCATCCGTTTCAGAGATGGATTGTGGACCGCCAGAACCA[C/T]AATCATCACATATGACATATTTAATCAACAATGGAACATTGTTTGGAGCC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Age-related macular degeneration: A genome-wide association study for primary open angle glaucoma and macular degeneration reveals novel Loci. (View Study)
- Erectile dysfunction: Pilot genome-wide association search identifies potential loci for risk of erectile dysfunction in type 1 diabetes using the DCCT/EDIC study cohort. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: