zgc:173552

Ensembl ID:
ENSDARG00000086709
ZFIN ID:
ZDB-GENE-080220-24
Description:
histone cluster 3, H3 [Source:RefSeq peptide;Acc:NP_001104686]
Human Orthologue:
H3F3C
Human Description:
H3 histone, family 3C [Source:HGNC Symbol;Acc:33164]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa27115 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa27115
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126541 Nonsense 100 136 1 1
Genomic Location (Zv9):
Chromosome 7 (position 76846468)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 73622273
GRCz11 7 73845437
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTTCCAGAGCTCCGCCGTCATGGCCCTGCAGGAGTCCAGCGAGGCTTA[T/A]CTGGTCGGCCTTTTCGAGGACACAAACCTGTGCGCCATCCACGCCAAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link