TRAF3IP3

Ensembl ID:
ENSDARG00000086708
Description:
TRAF3 interacting protein 3 [Source:HGNC Symbol;Acc:30766]
Human Orthologue:
TRAF3IP3
Human Description:
TRAF3 interacting protein 3 [Source:HGNC Symbol;Acc:30766]
Mouse Orthologue:
Traf3ip3
Mouse Description:
TRAF3 interacting protein 3 Gene [Source:MGI Symbol;Acc:MGI:2441706]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34406 Nonsense Mutation detected in F1 DNA During 2018
sa41208 Essential Splice Site Mutation detected in F1 DNA During 2018
sa34407 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34406
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129032 Nonsense 47 349 2 8
Genomic Location (Zv9):
Chromosome 8 (position 26196003)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25323921
GRCz11 8 25343060
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCCTCCCACAGACACGCTGTGATGAGGACGTGTTGAAGAGTAAGATT[A/T]AAGCTCTTGAGGCTCAACTGCAGGTCTGCATCAAGGTAAAACGGCAACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41208
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129032 Essential Splice Site 196 349 5 8
Genomic Location (Zv9):
Chromosome 8 (position 26199647)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25327565
GRCz11 8 25346704
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCAGGAGGAAAACCTCACACTGAGAGAGTATCTACAGGAGCTTACAG[G/T]TTCACCTCACATCTGTGCAGATCTTTCATTTAATGTAGCTTCATACGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34407
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129032 Essential Splice Site 197 349 5 8
Genomic Location (Zv9):
Chromosome 8 (position 26199648)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25327566
GRCz11 8 25346705
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCAGGAGGAAAACCTCACACTGAGAGAGTATCTACAGGAGCTTACAGG[T/G]TCACCTCACATCTGTGCAGATCTTTCATTTAATGTAGCTTCATACGTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link