zgc:56376

Ensembl ID:
ENSDARG00000086685
ZFIN ID:
ZDB-GENE-040426-1003
Description:
hypothetical protein LOC394070 [Source:RefSeq peptide;Acc:NP_957389]
Human Orthologues:
TRIM54, TRIM55, TRIM63
Human Descriptions:
tripartite motif-containing 54 [Source:HGNC Symbol;Acc:16008]
tripartite motif-containing 55 [Source:HGNC Symbol;Acc:14215]
tripartite motif-containing 63 [Source:HGNC Symbol;Acc:16007]
Mouse Orthologues:
Trim54, Trim55, Trim63
Mouse Descriptions:
tripartite motif-containing 54 Gene [Source:MGI Symbol;Acc:MGI:1889623]
tripartite motif-containing 55 Gene [Source:MGI Symbol;Acc:MGI:3036269]
tripartite motif-containing 63 Gene [Source:MGI Symbol;Acc:MGI:2447992]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27397 Nonsense Mutation detected in F1 DNA During 2018
sa11986 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa27397
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127859 Nonsense 226 348 1 1
ENSDART00000127859 Nonsense 226 348 1 1
Genomic Location (Zv9):
Chromosome 9 (position 24934845)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 24090631
GRCz11 9 23901500
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTGCCAAACAAAAGCTTGGCGAATGCTTCGATTCCCTCTATGCAGCCT[T/A]GGAGGAGCGTAAAAATGCCCTCTTAGAGCGTATTGGCAAAGAGCAAGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11986
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127859 Nonsense 226 348 1 1
ENSDART00000127859 Nonsense 226 348 1 1
Genomic Location (Zv9):
Chromosome 9 (position 24934845)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 24090631
GRCz11 9 23901500
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYGTGCCAAACAAAAGCTTGGCGAATGCTTCGATTCCCTCTATGCAGCCT[T/C]GGAGGAGCGTAAAAATGCCCTCTTAGAGCGTATTGGCAAAGAGCAAGACG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link