
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
DYNC2H1 (2 of 2)
- Ensembl ID:
- ENSDARG00000086671
- Description:
- dynein, cytoplasmic 2, heavy chain 1 [Source:HGNC Symbol;Acc:2962]
- Human Orthologue:
- DYNC2H1
- Human Description:
- dynein, cytoplasmic 2, heavy chain 1 [Source:HGNC Symbol;Acc:2962]
- Mouse Orthologue:
- Dync2h1
- Mouse Description:
- dynein cytoplasmic 2 heavy chain 1 Gene [Source:MGI Symbol;Acc:MGI:107736]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa36001 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa42628 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa36000 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa36001
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000125822 | Essential Splice Site | 678 | 1076 | 12 | 18 |
- Genomic Location (Zv9):
- Chromosome 15 (position 44041486)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 45022924 GRCz11 15 45153634 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACTGGCTCAATGATTATTTCCACAGAGCTCTGGAGTGGGTTCTCAAACAG[G/A]TGCATTCCTAAAGTCCATATGAACCGGAAGTTGCTGAGACTTTTATTTCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42628
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000125822 | Nonsense | 951 | 1076 | 17 | 18 |
- Genomic Location (Zv9):
- Chromosome 15 (position 44029333)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 45010771 GRCz11 15 45141481 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGACACACACACTCACACACACATACTTATCTATATCTCTGCATTAGTTA[T/A]CCAGACAGAGAGCAGCTGCAGACAGTCTATAGTGCGTACCTGAAACCTGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36000
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000125822 | Nonsense | 1028 | 1076 | 18 | 18 |
- Genomic Location (Zv9):
- Chromosome 15 (position 44027337)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 45008775 GRCz11 15 45139485 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGTTCACTCCATGTTTACTCACAGAGTGGGTCCTGAATCTGCTGCGGTA[C/A]GACCTGAGCGCAGGTGAGCTCAACACACTCAATAATTCACTAACATCTCC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Small-cell lung cancer: Genome-wide interrogation identifies YAP1 variants associated with survival of small-cell lung cancer patients. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: