zgc:136963

Ensembl ID:
ENSDARG00000086603
ZFIN ID:
ZDB-GENE-060312-8
Description:
hypothetical protein LOC664694 [Source:RefSeq peptide;Acc:NP_001034923]
Human Orthologue:
FUT9
Human Description:
fucosyltransferase 9 (alpha (1,3) fucosyltransferase) [Source:HGNC Symbol;Acc:4020]
Mouse Orthologue:
Fut9
Mouse Description:
fucosyltransferase 9 Gene [Source:MGI Symbol;Acc:MGI:1330859]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34280 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34280
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123553 Nonsense 243 355 2 3
Genomic Location (Zv9):
Chromosome 8 (position 3477662)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTAGCTGCAAATTTTACCTCTCTTTCGAGAACTCCATTCACGAGGACTA[T/G]TTTACAGAGAAGATCGAATTCCCTGAATGAAAGAGCCAAACTGCAGTTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link