
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
nrg2b
- Ensembl ID:
- ENSDARG00000086585
- ZFIN ID:
- ZDB-GENE-090205-2
- Description:
- neuregulin 2b [Source:RefSeq peptide;Acc:NP_001138563]
- Human Orthologue:
- NRG2
- Human Description:
- neuregulin 2 [Source:HGNC Symbol;Acc:7998]
- Mouse Orthologue:
- Nrg2
- Mouse Description:
- neuregulin 2 Gene [Source:MGI Symbol;Acc:MGI:1098246]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa35635 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa11366 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa35635
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000127494 | Nonsense | 155 | 599 | 4 | 11 |
ENSDART00000129055 | Nonsense | 261 | 697 | 4 | 10 |
- Genomic Location (Zv9):
- Chromosome 14 (position 8358739)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 8082529 GRCz11 14 8388643 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGTGCAATGAAACTGAGAAGACATACTGCATCAACGGTGGAGACTGTTA[T/A]TTCATACATGGTATAAATCAGCTGTCCTGCAAGTAAGTTACACATTGTCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11366
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000127494 | Essential Splice Site | 270 | 599 | 9 | 11 |
ENSDART00000129055 | Essential Splice Site | 368 | 697 | 8 | 10 |
- Genomic Location (Zv9):
- Chromosome 14 (position 8399147)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 8122391 GRCz11 14 8428505 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTGTCTGAATAGNTTTTGATTTGTCATCAAGCKTTTTTSNTTTTTATTGC[A/T]GTATATATCTAAGAATGTCCCGGCAACTGAACGAGTAGTACGACATGGAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: