TRIM14 (2 of 8)

Ensembl ID:
ENSDARG00000086581
Description:
tripartite motif-containing 14 [Source:HGNC Symbol;Acc:16283]
Human Orthologue:
TRIM14
Human Description:
tripartite motif-containing 14 [Source:HGNC Symbol;Acc:16283]
Mouse Orthologue:
Trim14
Mouse Description:
tripartite motif-containing 14 Gene [Source:MGI Symbol;Acc:MGI:1921985]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30365 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30365
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122950 Nonsense 49 189 2 2
Genomic Location (Zv9):
Chromosome Zv9_scaffold3519 (position 180301)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75712839
GRCz11 21 2941083
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTCTGAGGAGAACAGAGAGGTGACCCATGTGAGAGAGAATCAGCCGTA[T/A]CCTGATCATCCAGACAGATTTGATCATCCTCATCAGGTGTTGTGCAGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link