zgc:114037

Ensembl ID:
ENSDARG00000086546
ZFIN ID:
ZDB-GENE-050731-6
Description:
histone 2, H2a [Source:RefSeq peptide;Acc:NP_001026996]
Human Orthologue:
H2AFX
Human Description:
H2A histone family, member X [Source:HGNC Symbol;Acc:4739]
Mouse Orthologue:
H2afx
Mouse Description:
H2A histone family, member X Gene [Source:MGI Symbol;Acc:MGI:102688]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11764 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11764
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123183 Nonsense 82 128 1 1
Genomic Location (Zv9):
Chromosome 7 (position 6801229)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 5835567
GRCz11 7 5957214
KASP Assay ID:
2259-8408.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTGGCTGGAAACGCTGCTCGGGACAACAAGAAGACYCGCATCATTCCC[C/T]GACACCTTCARCTGGCGGTGCGCAATGATGAGGAGCTGAACAAACTTYTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link