si:dkey-92f12.2

Ensembl ID:
ENSDARG00000086490
ZFIN ID:
ZDB-GENE-091204-379
Human Orthologue:
SUN2
Human Description:
Sad1 and UNC84 domain containing 2 [Source:HGNC Symbol;Acc:14210]
Mouse Orthologue:
Sun2
Mouse Description:
Sad1 and UNC84 domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2443011]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20810 Nonsense Available for shipment Available now
sa30877 Nonsense Mutation detected in F1 DNA During 2018
sa40788 Nonsense Mutation detected in F1 DNA During 2018
sa16555 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20810
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129701 Nonsense 4 577 1 17
ENSDART00000140086 Nonsense 4 577 2 18

The following transcripts of ENSDARG00000086490 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 47986075)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 48046727
GRCz11 6 48045486
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTACTTTTACACAGTCTATGTTTGTATGTGTTCTGCAGAGATGTCAAGA[C/T]GAAGCACAAGATCAGTGACCAAACCGACGTCCTTTCCTGACGATGACGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30877
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129701 Nonsense 101 577 3 17
ENSDART00000140086 Nonsense 101 577 4 18
ENSDART00000129701 Nonsense 101 577 3 17
ENSDART00000140086 Nonsense 101 577 4 18

The following transcripts of ENSDARG00000086490 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 47986764)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 48047416
GRCz11 6 48046175
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACTCAAGGATTTTCCTCTGGATATTCCTCAGCTGAGGATCATTATGAA[C/T]AACCCATAAAGTCAAACCCTAGTAAGTGTTCGTTATTCAATTTCATACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40788
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129701 Nonsense 101 577 3 17
ENSDART00000140086 Nonsense 101 577 4 18
ENSDART00000129701 Nonsense 101 577 3 17
ENSDART00000140086 Nonsense 101 577 4 18

The following transcripts of ENSDARG00000086490 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 47986764)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 48047416
GRCz11 6 48046175
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACTCAAGGATTTTCCTCTGGATATTCCTCAGCTGAGGATCATTATGAA[C/T]AACCCATAAAGTCAAACCCTAGTAAGTGTTCGTTATTCAATTTCATACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16555
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129701 Nonsense 344 577 12 17
ENSDART00000140086 Nonsense 344 577 13 18

The following transcripts of ENSDARG00000086490 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 47993108)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 48053760
GRCz11 6 48052519
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAAGATCCAAGCTCWCTGGAWTCAAGTATAGTGCTGCGCCCGGAGCTG[C/T]AGAGGGCGCTACAGGATCTGGAGAAGCAGATACTAGAGAAACTAGCACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link