
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
NAALADL2
- Ensembl ID:
- ENSDARG00000086489
- Description:
- N-acetylated alpha-linked acidic dipeptidase-like 2 [Source:HGNC Symbol;Acc:23219]
- Human Orthologue:
- NAALADL2
- Human Description:
- N-acetylated alpha-linked acidic dipeptidase-like 2 [Source:HGNC Symbol;Acc:23219]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa8489 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa13956 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa8489
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000124127 | Nonsense | 433 | 783 | 8 | 14 |
- Genomic Location (Zv9):
- Chromosome 11 (position 9239735)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 9141646 GRCz11 11 9148732 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTCTTGTTTGTGTKAAAGTAAGTGTCCCCGCTCTGTTTCCCCTTGTAGAT[C/T]GATATGTCCTGGTTGGCAGTCGTCATGGCAGCTGGTATGAGGGTGCGTTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13956
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000124127 | Essential Splice Site | 592 | 783 | 10 | 14 |
- Genomic Location (Zv9):
- Chromosome 11 (position 9186131)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 9088042 GRCz11 11 9095128 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGGAGTGCCTACGGTGGAGWTCACATACGCAGAGGTCCCTAAAACAGAGG[T/A]ACAATACTTTCACATACNNNNNNNNNNNNAATAATTCAAACATTCTTTAC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Height: Genome-wide association study in Han Chinese identifies three novel loci for human height. (View Study)
- Kawasaki disease: A genome-wide association study identifies novel and functionally related susceptibility Loci for Kawasaki disease. (View Study)
- Metabolite levels (MHPG): Genome-wide association study of monoamine metabolite levels in human cerebrospinal fluid. (View Study)
- Systemic lupus erythematosus: Differential genetic associations for systemic lupus erythematosus based on anti-dsDNA autoantibody production. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: