
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:163008
- Ensembl ID:
- ENSDARG00000086463
- ZFIN ID:
- ZDB-GENE-030131-2671
- Description:
- kelch-like 9 [Source:RefSeq peptide;Acc:NP_001092699]
- Human Orthologues:
- KLHL13, KLHL9
- Human Descriptions:
- kelch-like 13 (Drosophila) [Source:HGNC Symbol;Acc:22931]
- kelch-like 9 (Drosophila) [Source:HGNC Symbol;Acc:18732]
- Mouse Orthologues:
- Klhl13, Klhl9
- Mouse Descriptions:
- kelch-like 13 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1914705]
- kelch-like 9 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2180122]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa20481 | Nonsense | Available for shipment | Available now |
sa25306 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa12111 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa20481
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000128122 | Nonsense | 355 | 615 | 6 | 8 |
- Genomic Location (Zv9):
- Chromosome 5 (position 39023867)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 36823551 GRCz11 5 37423704 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACCAGCATGGCATCGCAGTGATCGGGAACTTTTTGTATGTGGTCGGTGGA[C/T]AGAGTAACTATGACACGAAAGGTAAAACGGCAGTGGATACCGTGTTTCGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa25306
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000128122 | Nonsense | 372 | 615 | 6 | 8 |
- Genomic Location (Zv9):
- Chromosome 5 (position 39023920)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 36823604 GRCz11 5 37423757 - KASP Assay ID:
- 554-7732.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGTAACTATGACACGAAAGGTAAAACGGCAGTGGATACCGTGTTTCGCTA[T/A]GACCCCAGGTATAACAAGTGGATTCAGGTGGCATGTCTAAATGAGAAGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12111
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000128122 | Nonsense | 419 | 615 | 7 | 8 |
- Genomic Location (Zv9):
- Chromosome 5 (position 39033554)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 36833238 GRCz11 5 37433391 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTCAGTTTTTTTCTCTTTTCTTGTCTTTCTCCAGCAACGGTAGAGWGTTA[T/G]AACCCCAGAACMAATGAATGGACGTATGTGGCCAAAATGAGCGAGCCGCA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Iron status biomarkers: Variants in TF and HFE explain approximately 40% of genetic variation in serum-transferrin levels. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: