zgc:163008

Ensembl ID:
ENSDARG00000086463
ZFIN ID:
ZDB-GENE-030131-2671
Description:
kelch-like 9 [Source:RefSeq peptide;Acc:NP_001092699]
Human Orthologues:
KLHL13, KLHL9
Human Descriptions:
kelch-like 13 (Drosophila) [Source:HGNC Symbol;Acc:22931]
kelch-like 9 (Drosophila) [Source:HGNC Symbol;Acc:18732]
Mouse Orthologues:
Klhl13, Klhl9
Mouse Descriptions:
kelch-like 13 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1914705]
kelch-like 9 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2180122]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20481 Nonsense Available for shipment Available now
sa25306 Nonsense Mutation detected in F1 DNA During 2018
sa12111 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20481
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128122 Nonsense 355 615 6 8
Genomic Location (Zv9):
Chromosome 5 (position 39023867)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36823551
GRCz11 5 37423704
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAGCATGGCATCGCAGTGATCGGGAACTTTTTGTATGTGGTCGGTGGA[C/T]AGAGTAACTATGACACGAAAGGTAAAACGGCAGTGGATACCGTGTTTCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25306
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128122 Nonsense 372 615 6 8
Genomic Location (Zv9):
Chromosome 5 (position 39023920)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36823604
GRCz11 5 37423757
KASP Assay ID:
554-7732.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTAACTATGACACGAAAGGTAAAACGGCAGTGGATACCGTGTTTCGCTA[T/A]GACCCCAGGTATAACAAGTGGATTCAGGTGGCATGTCTAAATGAGAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12111
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128122 Nonsense 419 615 7 8
Genomic Location (Zv9):
Chromosome 5 (position 39033554)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36833238
GRCz11 5 37433391
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAGTTTTTTTCTCTTTTCTTGTCTTTCTCCAGCAACGGTAGAGWGTTA[T/G]AACCCCAGAACMAATGAATGGACGTATGTGGCCAAAATGAGCGAGCCGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link