si:ch211-236p5.3

Ensembl ID:
ENSDARG00000086418
ZFIN ID:
ZDB-GENE-081028-31
Human Orthologue:
NLRC5
Human Description:
NLR family, CARD domain containing 5 [Source:HGNC Symbol;Acc:29933]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45594 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45594
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125728 Nonsense 547 1020 3 7
ENSDART00000141987 Nonsense 432 570 1 1
Genomic Location (Zv9):
Chromosome 17 (position 8138581)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8141355
GRCz11 17 8298533
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATATGAAGTCAAGAATAAAGAGTCACTGAAGTTATATCTGAAGGGATA[T/G]AAATGGTACAGCCGAGAAATCTCTCTGTTTGATCTACTTGAAGGCTCCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Schizophrenia: Genome-wide association study in a Swedish population yields support for greater CNV and MHC involvement in schizophrenia compared with bipolar disorder. (View Study)
  • Schizophrenia: Genome-wide association study of clinical dimensions of schizophrenia: polygenic effect on disorganized symptoms. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link