zgc:171717

Ensembl ID:
ENSDARG00000086408
ZFIN IDs:
ZDB-GENE-070705-50, ZDB-GENE-070705-50, ZDB-GENE-071004-25
Description:
hypothetical protein LOC795141 [Source:RefSeq peptide;Acc:NP_001098604]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6713 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6713
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125995   None 148 None 6
ENSDART00000137341 Nonsense 3 168 1 6
Genomic Location (Zv9):
Chromosome 22 (position 25747188)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 25247094
GRCz11 22 25274718
KASP Assay ID:
554-5244.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCGGTGTGAAGTACAGGTGTCGCTCATTACCACTCACACCAGCGGCCTA[T/G]AAATATGAATCAGTAAAKACGACATGCACAGTTGCAGACAACAGAAGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link