VPS13B (3 of 5)

Ensembl ID:
ENSDARG00000086406
Description:
vacuolar protein sorting 13 homolog B (yeast) [Source:HGNC Symbol;Acc:2183]
Human Orthologue:
VPS13B
Human Description:
vacuolar protein sorting 13 homolog B (yeast) [Source:HGNC Symbol;Acc:2183]
Mouse Orthologue:
Vps13b
Mouse Description:
vacuolar protein sorting 13B (yeast) Gene [Source:MGI Symbol;Acc:MGI:1916380]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36275 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36275
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125810 Essential Splice Site 100 119 2 3
Genomic Location (Zv9):
Chromosome 16 (position 57883301)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTAAACCAATCGGAGGAGCCGCTGAGCTGGTGTCACAGACGGGCTACG[G/A]TACACACACACACACACACACAGCAGAGAGAGAGAGTGTCTGTGTGAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link