Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
FMN1 (2 of 3)
- Ensembl ID:
- ENSDARG00000086384
- Description:
- formin 1 [Source:HGNC Symbol;Acc:3768]
- Human Orthologue:
- FMN1
- Human Description:
- formin 1 [Source:HGNC Symbol;Acc:3768]
- Mouse Orthologue:
- Fmn1
- Mouse Description:
- formin 1 Gene [Source:MGI Symbol;Acc:MGI:101815]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa24825 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa24825
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000130502 | Essential Splice Site | 149 | 258 | 5 | 8 |
- Genomic Location (Zv9):
- Chromosome Zv9_NA233 (position 34321)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 34321 GRCz11 17 34321 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGGATTTGGACTGGAGATTCTGCCTAAATTAAAAGACGTCAAGAGCAGG[G/T]TAACCAAAAGCAAACACACCCAAAGCTGCACTAAATATACGGTTGGAGTC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Major depressive disorder: Common genetic variation and antidepressant efficacy in major depressive disorder: a meta-analysis of three genome-wide pharmacogenetic studies. (View Study)
- Orofacial clefts: Genome-wide association study identifies two susceptibility loci for nonsyndromic cleft lip with or without cleft palate. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
