taar12e

Ensembl ID:
ENSDARG00000086376
ZFIN ID:
ZDB-GENE-041014-51
Description:
trace amine associated receptor 12e [Source:RefSeq peptide;Acc:NP_001076563]
Human Orthologue:
TAAR2
Human Description:
trace amine associated receptor 2 [Source:HGNC Symbol;Acc:4514]
Mouse Orthologues:
Taar2, Taar3
Mouse Descriptions:
trace amine-associated receptor 2 Gene [Source:MGI Symbol;Acc:MGI:2685071]
trace amine-associated receptor 3 Gene [Source:MGI Symbol;Acc:MGI:3527427]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43526 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43526
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126469 Nonsense 109 336 1 2
ENSDART00000143078 Nonsense 112 337 1 1
Genomic Location (Zv9):
Chromosome 20 (position 46264379)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46157594
GRCz11 20 46061314
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGGCTGCTGGTATCTGGGAGATGTTGTGTGTAAAGTTCATTCTAGTT[T/A]GGACATGACTTTCTGTATCTCATCTTTACTGCATCTCGGTTTAATATCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link