zgc:110064

Ensembl ID:
ENSDARG00000086370
ZFIN ID:
ZDB-GENE-050522-366
Description:
apolipoprotein E [Source:RefSeq peptide;Acc:NP_001018401]
Human Orthologue:
APOE
Human Description:
apolipoprotein E [Source:HGNC Symbol;Acc:613]
Mouse Orthologue:
Apoe
Mouse Description:
apolipoprotein E Gene [Source:MGI Symbol;Acc:MGI:88057]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36796 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36796
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123090 Nonsense 161 269 3 4
Genomic Location (Zv9):
Chromosome 19 (position 11957828)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10937359
GRCz11 19 10856284
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCCAAGAAATTAAGGAAACGATTTAACAAGGACATCCAGGAGATCAAC[A/T]AGTAAGTTGCTTGTTTTTTGGTTCACTTCTATAAAAGATACACATCCTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link