
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000086367
- Ensembl ID:
- ENSDARG00000086367
- Human Orthologues:
- BX248098.1, ZNF107, ZNF160, ZNF197, ZNF208, ZNF616, ZNF658, ZNF721, ZNF729, ZNF808, ZNF836, ZNF841, ZNF845, ZNF91, ZNF99
- Human Descriptions:
- zinc finger protein 107 [Source:HGNC Symbol;Acc:12887]
- zinc finger protein 160 [Source:HGNC Symbol;Acc:12948]
- zinc finger protein 197 [Source:HGNC Symbol;Acc:12988]
- zinc finger protein 208 [Source:HGNC Symbol;Acc:12999]
- zinc finger protein 616 [Source:HGNC Symbol;Acc:28062]
- zinc finger protein 658 [Source:HGNC Symbol;Acc:25226]
- Zinc finger protein 658B [Source:UniProtKB/Swiss-Prot;Acc:Q4V348]
- zinc finger protein 721 [Source:HGNC Symbol;Acc:29425]
- zinc finger protein 729 [Source:HGNC Symbol;Acc:32464]
- zinc finger protein 808 [Source:HGNC Symbol;Acc:33230]
- zinc finger protein 836 [Source:HGNC Symbol;Acc:34333]
- zinc finger protein 841 [Source:HGNC Symbol;Acc:27611]
- zinc finger protein 845 [Source:HGNC Symbol;Acc:25112]
- zinc finger protein 91 [Source:HGNC Symbol;Acc:13166]
- zinc finger protein 99 [Source:HGNC Symbol;Acc:13175]
- Mouse Orthologues:
- A530054K11Rik, AA987161, Zfp748
- Mouse Descriptions:
- expressed sequence AA987161 Gene [Source:MGI Symbol;Acc:MGI:2145180]
- RIKEN cDNA A530054K11 gene Gene [Source:MGI Symbol;Acc:MGI:3036250]
- zinc finger protein 748 Gene [Source:MGI Symbol;Acc:MGI:1916455]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa30331 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa30331
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000123486 | Nonsense | 526 | 990 | 6 | 9 |
- Genomic Location (Zv9):
- Chromosome Zv9_scaffold3465 (position 128705)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 71326061 GRCz11 4 72983842 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGAGAAACCTTTCACATGCCAACAATGCGGAATGAGTTTCCGTATAAAA[C/T]AGAAATTATGTTGTCACATGAGAGTTCACACCGGAGAGAAACCGTACACC
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: