zgc:194508

Ensembl ID:
ENSDARG00000086310
ZFIN ID:
ZDB-GENE-081022-119
Description:
hypothetical protein LOC100004673 [Source:RefSeq peptide;Acc:NP_001170934]
Human Orthologue:
C10orf107
Human Description:
chromosome 10 open reading frame 107 [Source:HGNC Symbol;Acc:28678]
Mouse Orthologue:
1700040L02Rik
Mouse Description:
RIKEN cDNA 1700040L02 gene Gene [Source:MGI Symbol;Acc:MGI:1920537]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41966 Nonsense Mutation detected in F1 DNA During 2018
sa45450 Nonsense Mutation detected in F1 DNA During 2018
sa35213 Splice Site, Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41966
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124084 Nonsense 63 359 3 9
Genomic Location (Zv9):
Chromosome 12 (position 8739853)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 8043451
GRCz11 12 8077434
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGATTATTTTAATGGTATGCAGTATTTTCTTGCATTTTCAGACAGTTT[G/T]AAAATATTCTCCATTTCAAAAACCATCAAACATGTTTGAAGGAAGCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45450
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124084 Nonsense 138 359 4 9
Genomic Location (Zv9):
Chromosome 12 (position 8740529)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 8044127
GRCz11 12 8078110
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTGCTGATAATTTCAAGGCATTTACCCAAGCAGTGCTTTCCACAAGA[C/T]AGTCTCCATCAACAAAAGACAGTTCTTTATTCAACAATGATCAAATCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35213
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124084 Splice Site, Nonsense 225 359 6 9
Genomic Location (Zv9):
Chromosome 12 (position 8752435)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 8056033
GRCz11 12 8090016
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGACCTCTACTTCCATTACATGGCTCCCCCATGTGCGCAAACACCTGAA[C/T]AGGTAAAATGTTCTTTTTGTGATTACATTTACATTTAGTAATTTAGCAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link