Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000086308
- Ensembl ID:
- ENSDARG00000086308
Alleles
There are 3 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa35186 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa27862 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa24901 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa35186
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000126772 | Nonsense | 236 | 437 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 12 (position 3990156)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 3284582 GRCz11 12 3396222 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTCTGGTACCACTGCTGTATGTTGCTGTATTCTGCTGTATGTTGCTGTA[T/A]TCTGCTGTATTTTGCGGTATCACTGATGTATGTTGCTGTATTCTACTGTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa27862
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000126772 | Nonsense | 396 | 437 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 12 (position 3990636)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 3285062 GRCz11 12 3396702 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCACTGCTGTATGTTGCTGTGTTCTGCTATATTTTGCGGTACCAATGCTG[T/A]ATGTTGCTGTATTCAGATATATTTTGCGGTACCACTGCTGTATGTTGCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24901
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000126772 | Nonsense | 412 | 437 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 12 (position 3990684)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 3285110 GRCz11 12 3396750 - KASP Assay ID:
- 554-7861.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTATGTTGCTGTATTCAGATATATTTTGCGGTACCACTGCTGTATGTTG[C/A]TGTATTCTGCTGTATTTTGCGGTACCACTGCTGTATGTTGCTGTATTCTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
