ADAP1

Ensembl ID:
ENSDARG00000086306
Description:
ArfGAP with dual PH domains 1 [Source:HGNC Symbol;Acc:16486]
Human Orthologue:
ADAP1
Human Description:
ArfGAP with dual PH domains 1 [Source:HGNC Symbol;Acc:16486]
Mouse Orthologue:
Adap1
Mouse Description:
ArfGAP with dual PH domains 1 Gene [Source:MGI Symbol;Acc:MGI:2442201]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41930 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41930
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128113 Essential Splice Site 72 157 3 5
Genomic Location (Zv9):
Chromosome 12 (position 1268289)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 1131597
GRCz11 12 1063823
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGTTCACTATGGACGACCGCAGACTCATGTACTTCAAAGATCCACTGG[T/C]GAGGAAACACTGATCAAATGATATTTATAATGCTTTAACACTGTTTACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link