
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000086298
- Ensembl ID:
- ENSDARG00000086298
- Human Orthologue:
- DNAH11
- Human Description:
- dynein, axonemal, heavy chain 11 [Source:HGNC Symbol;Acc:2942]
- Mouse Orthologue:
- Dnahc11
- Mouse Description:
- dynein, axonemal, heavy chain 11 Gene [Source:MGI Symbol;Acc:MGI:1100864]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa30419 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa38205 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa30419
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000124466 | Essential Splice Site | 143 | 479 | 3 | 11 |
- Genomic Location (Zv9):
- Chromosome Zv9_NA667 (position 9246)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 10434830 GRCz11 KZ116000.1 9246 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACCGATATTCTTCATCAGACTAGAGGAGCCCTACAAACTCATTGACAAG[G/T]TACTTTTGTGTTTTTATTTCTGAGTGTGTTTTCAACTCATTGCCAAAGTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38205
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000124466 | Essential Splice Site | 143 | 479 | 3 | 11 |
- Genomic Location (Zv9):
- Chromosome Zv9_NA667 (position 9245)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 10434829 GRCz11 KZ116000.1 9245 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACCGATATTCTTCATCAGACTAGAGGAGCCCTACAAACTCATTGACAAGG[T/C]ACTTTTGTGTTTTTATTTCTGAGTGTGTTTTCAACTCATTGCCAAAGTGG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Multiple cancers (lung cancer, gastric cancer, and squamous cell carcinoma): Genetic variants at 6p21.1 and 7p15.3 are associated with risk of multiple cancers in Han Chinese. (View Study)
- Multiple myeloma: Common variation at 3p22.1 and 7p15.3 influences multiple myeloma risk. (View Study)
- Total ventricular volume: Genome-wide association with MRI atrophy measures as a quantitative trait locus for Alzheimer's disease. (View Study)
- Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)
- Triglycerides: Loci influencing lipid levels and coronary heart disease risk in 16 European population cohorts. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: