si:dkey-32o22.2

Ensembl ID:
ENSDARG00000086215
ZFIN ID:
ZDB-GENE-081104-409
Human Orthologue:
GPR156
Human Description:
G protein-coupled receptor 156 [Source:HGNC Symbol;Acc:20844]
Mouse Orthologue:
Gpr156
Mouse Description:
G protein-coupled receptor 156 Gene [Source:MGI Symbol;Acc:MGI:2653880]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10879 Nonsense Available for shipment Available now
sa25418 Nonsense Mutation detected in F1 DNA During 2018
sa34566 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa10879
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128704 Nonsense 460 800 9 9
ENSDART00000139138   None 161 None 4
ENSDART00000147378   None 136 None 2
Genomic Location (Zv9):
Chromosome 9 (position 9901934)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 9702485
GRCz11 9 9680522
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTCCACCTCCCTATGTACCTCCTCCACCAATTCCCATCCAYACTACCT[C/A]AARTGCAAMATCCCCTGAAGGTCCAGGAGCTACAGATRAGTCTTCACCAY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25418
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128704 Nonsense 697 800 9 9
ENSDART00000139138   None 161 None 4
ENSDART00000147378   None 136 None 2
Genomic Location (Zv9):
Chromosome 9 (position 9901224)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 9701775
GRCz11 9 9679812
KASP Assay ID:
554-7333.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGGAGGAGTAAAAGGGCAGAGAAAGCACAGACTCAGAGCAACTCAGGA[C/T]AGGACAGTTGGCAATGTTCTTCTCACAAATGTTCGATTACTCCTTTCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34566
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128704 Nonsense 737 800 9 9
ENSDART00000139138   None 161 None 4
ENSDART00000147378   None 136 None 2
Genomic Location (Zv9):
Chromosome 9 (position 9901102)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 9701653
GRCz11 9 9679690
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGCTGGACTGATAGAGGAGGTTAAACACTCTAAGGAGCCATATGACTA[T/A]TCAGACTCAGACTCCAGCAGCTCGGAGGACTACTGTTACTACCAGCGGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link