ENSDARG00000086190

Ensembl ID:
ENSDARG00000086190

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36140 Nonsense Mutation detected in F1 DNA During 2018
sa45576 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36140
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123140 Nonsense 88 454 1 4
Genomic Location (Zv9):
Chromosome 16 (position 28103622)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25949204
GRCz11 16 25864236
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAACAGCCAGCTTTTAAAGAGCTGATTGCAACTTTGCAACCACAATCT[A/T]AAGTCATTTCCAGATCCACTGTCTGTGGCAGAATCACTGATGCTGCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45576
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123140 Nonsense 96 454 1 4
Genomic Location (Zv9):
Chromosome 16 (position 28103596)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25949178
GRCz11 16 25864210
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGCAACTTTGCAACCACAATCTAAAGTCATTTCCAGATCCACTGTCTG[T/A]GGCAGAATCACTGATGCTGCTGATGACCTAAAGAAAACAATAATAACAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link