wu:fi13h06

Ensembl ID:
ENSDARG00000086126
ZFIN ID:
ZDB-GENE-030131-5695
Human Orthologue:
TRIM28
Human Description:
tripartite motif-containing 28 [Source:HGNC Symbol;Acc:16384]
Mouse Orthologue:
Trim28
Mouse Description:
tripartite motif-containing 28 Gene [Source:MGI Symbol;Acc:MGI:109274]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14209 Nonsense Available for shipment Available now
sa36163 Nonsense Available for shipment Available now
sa22864 Essential Splice Site Available for shipment Available now
sa39104 Nonsense Mutation detected in F1 DNA During 2018
sa36164 Nonsense Mutation detected in F1 DNA During 2018
sa16868 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14209
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122433 Nonsense 10 1293 1 17
Genomic Location (Zv9):
Chromosome 16 (position 30992424)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28829562
GRCz11 16 28764185
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCNNTTTTTTTTAAGTAACAGATGTTTACCRCTGGCCCGACAGGGCGTT[C/A]AGCGTCGCCCCGTCCGGATTTGCAAAAAGCGGTTTGCGGAACTTGTGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36163
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122433 Nonsense 164 1293 4 17
Genomic Location (Zv9):
Chromosome 16 (position 30995305)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28832443
GRCz11 16 28767066
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCCTTACACTCTCAGGAAAGCTTGAGGTTCTTTTGTCTTGTTTGTGAA[G/T]AGCTCACCTGTAAAGACTGTCAGCTGATCACTCATAGAGGACACAGGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22864
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122433 Essential Splice Site 218 1293 6 17
Genomic Location (Zv9):
Chromosome 16 (position 30999965)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28837103
GRCz11 16 28771726
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTGTGTCTATAATTAATCCATTGTTGTGAGTATTGTTATCTTTGTTTA[G/A]ATTACAGGACATAGAGCATGTGAAAATGTTAACGAAGAAGTTATTGATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39104
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122433 Nonsense 599 1293 9 17
Genomic Location (Zv9):
Chromosome 16 (position 31003818)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28840956
GRCz11 16 28775579
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACCAAACATCTATACCAACTCATCCAATACCAGGCAGCAATCAACCTT[T/A]ATTACTGCAGCAAATACCAGCCAACACCCAATCAACCCTATTGACCCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36164
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122433 Nonsense 1037 1293 13 17
Genomic Location (Zv9):
Chromosome 16 (position 31009504)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28846642
GRCz11 16 28781265
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAATGGTCTTATTTGCTCTGGTTTTATCCTGTTCTTCTCCAGATTAAG[C/T]AGGTGTGGCGATGGCATGATGGTCCAGTAGCATCCAGAGCCTCCTCCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16868
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122433 Nonsense 1057 1293 13 17
Genomic Location (Zv9):
Chromosome 16 (position 31009564)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28846702
GRCz11 16 28781325
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGGCATGATGGTCCAGTAGCATCCAGAGCCTCCTCCTGCTCTACATCA[C/T]AGATGAGTGACATCGACAGCTCTCCGGCGTCTGATGTACAGTTCTGTGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link