Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch73-72b7.1
- Ensembl ID:
- ENSDARG00000086109
- ZFIN ID:
- ZDB-GENE-100921-23
- Human Orthologue:
- UNC5C
- Human Description:
- unc-5 homolog C (C. elegans) [Source:HGNC Symbol;Acc:12569]
- Mouse Orthologue:
- Unc5c
- Mouse Description:
- unc-5 homolog C (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1095412]
Alleles
There are 6 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa8687 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
| sa38449 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
| sa5282 | Nonsense | F2 line generated | During 2018 |
| sa38448 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
| sa30857 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa40361 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa8687
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000131156 | Essential Splice Site | 49 | 509 | 1 | 8 |
| ENSDART00000131473 | Essential Splice Site | 175 | 620 | 3 | 10 |
The following transcripts of ENSDARG00000086109 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 5 (position 8879132)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 6944062 GRCz11 5 7435217 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGTGCTGAACGGCGGATTTCAGCCTGTCAGCATCAAACAAGCACGATCAG[G/A]TGACMCCTTCACACCTCWCTGCAYTGAAAACAAATCACTCACTGGNNNNN
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38449
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000131156 | Essential Splice Site | 198 | 509 | 3 | 8 |
| ENSDART00000131473 | Essential Splice Site | 324 | 620 | 5 | 10 |
The following transcripts of ENSDARG00000086109 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 5 (position 8866104)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 6957090 GRCz11 5 7448245 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTCGAGTGTATGAGATGTATGTGAGCTTACAGAGGACAGAAAGCATGAGG[T/G]AAGACAAAAACACACAACCCACTTACTAAACACACATTCAGGATTCACAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa5282
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000131156 | Nonsense | 375 | 509 | 6 | 8 |
| ENSDART00000131473 | Nonsense | 501 | 620 | 8 | 10 |
The following transcripts of ENSDARG00000086109 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 5 (position 8855136)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 6968058 GRCz11 5 7459213 - KASP Assay ID:
- 554-3501.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACCACAACTTGAGACTGTCAGTCCACGATATCCACTGCCAGTGGAGGAGC[A/T]AACTTCTGACCAAATACCAGGTACAACACAACACACTCACCACCTTCACT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38448
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000131156 | Essential Splice Site | 381 | 509 | None | 8 |
| ENSDART00000131473 | Essential Splice Site | 507 | 620 | None | 10 |
The following transcripts of ENSDARG00000086109 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 5 (position 8855114)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 6968080 GRCz11 5 7459235 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCACGATATCCACTGCCAGTGGAGGAGCAAACTTCTGACCAAATACCAGG[T/C]ACAACACAACACACTCACCACCTTCACTGAAGTAAACAGTATGAATATAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa30857
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000131156 | 483 | 509 | 8 | 8 | |
| ENSDART00000131473 | Nonsense | 608 | 620 | 10 | 10 |
| ENSDART00000131156 | 483 | 509 | 8 | 8 | |
| ENSDART00000131473 | Nonsense | 608 | 620 | 10 | 10 |
The following transcripts of ENSDARG00000086109 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 5 (position 8844403)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 6978791 GRCz11 5 7469946 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATCAGAAACAAACTGTGCAGCAGTCTGGACGCACCACACACACGCGGAAA[C/T]GACTGGAGGAAACTGGCTCACAAACTACAGCTCGACAGGTCATTGCACAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40361
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000131156 | 483 | 509 | 8 | 8 | |
| ENSDART00000131473 | Nonsense | 608 | 620 | 10 | 10 |
| ENSDART00000131156 | 483 | 509 | 8 | 8 | |
| ENSDART00000131473 | Nonsense | 608 | 620 | 10 | 10 |
The following transcripts of ENSDARG00000086109 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 5 (position 8844403)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 6978791 GRCz11 5 7469946 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATCAGAAACAAACTGTGCAGCAGTCTGGACGCACCACACACACGCGGAAA[C/T]GACTGGAGGAAACTGGCTCACAAACTACAGCTCGACAGGTCATTGCACAT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
- T-tau: Genome-wide association reveals genetic effects on human Aβ42 and τ protein levels in cerebrospinal fluids: a case control study. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
