zgc:101659

Ensembl ID:
ENSDARG00000086103
ZFIN ID:
ZDB-GENE-041114-151
Description:
glycerol-3-phosphate transporter [Source:RefSeq peptide;Acc:NP_001007440]
Human Orthologue:
SLC37A1
Human Description:
solute carrier family 37 (glycerol-3-phosphate transporter), member 1 [Source:HGNC Symbol;Acc:11024]
Mouse Orthologue:
Slc37a1
Mouse Description:
solute carrier family 37 (glycerol-3-phosphate transporter), member 1 Gene [Source:MGI Symbol;Acc:MG

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41394 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41394
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129423 Essential Splice Site 444 525 15 18
Genomic Location (Zv9):
Chromosome 9 (position 20014724)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTCAATGGACCATATGCTCTCATCACAACAGCTGTTTCTGCTGACCTG[G/A]TAAGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link