zgc:162999

Ensembl ID:
ENSDARG00000086030
ZFIN ID:
ZDB-GENE-070424-78
Description:
poly(rC)-binding protein 3 [Source:RefSeq peptide;Acc:NP_001083021]
Human Orthologue:
PCBP3
Human Description:
poly(rC) binding protein 3 [Source:HGNC Symbol;Acc:8651]
Mouse Orthologue:
Pcbp3
Mouse Description:
poly(rC) binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:1890470]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24772 Essential Splice Site Available for shipment Available now
sa30409 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa24772
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044386 Essential Splice Site 44 350 4 13
Genomic Location (Zv9):
Chromosome Zv9_NA887 (position 41690)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAATTATTCTTTTCAGAAAGGGGAAACTGTGAAGAAGATGCGTGAAGAA[G/A]TAAGTAGTCACTTTTGTTTTAAGGTGTCCTTGTTACAAGTTCCACTCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30409
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044386 Nonsense 59 350 5 13
Genomic Location (Zv9):
Chromosome Zv9_NA887 (position 40188)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTACAGAGTAGCGCACGCATTAATATTTCAGAGGGAAACTGTCCTGAG[A/T]GAATAGTTACCATCACAGGACCCACAGATGCCATATTCAAGGCCTTCGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Insulin resistance/response: Genome-wide detection of allele specific copy number variation associated with insulin resistance in African Americans from the HyperGEN study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link