Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch73-389o21.2
- Ensembl ID:
- ENSDARG00000083189
- ZFIN ID:
- ZDB-GENE-100922-157
- Human Orthologue:
- ARHGAP19
- Human Description:
- Rho GTPase activating protein 19 [Source:HGNC Symbol;Acc:23724]
- Mouse Orthologue:
- Arhgap19
- Mouse Description:
- Rho GTPase activating protein 19 Gene [Source:MGI Symbol;Acc:MGI:1918335]
Alleles
There are 2 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa37564 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
| sa30733 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa37564
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000116455 | Essential Splice Site | 130 | 454 | 3 | 12 |
| ENSDART00000133537 | Essential Splice Site | 130 | 454 | 3 | 11 |
- Genomic Location (Zv9):
- Chromosome 22 (position 37809541)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 34994421 GRCz11 22 34970170 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGAAGAAGGAATAGCCCAGATATATCAGCTCATCGCTTACCTCAGCAAAA[G/A]TAAGTGCATGATATTAATAAAGTTGATGGCTTTATTATACAGTTCACCCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa30733
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000116455 | Nonsense | 301 | 454 | 6 | 12 |
| ENSDART00000133537 | Nonsense | 301 | 454 | 6 | 11 |
- Genomic Location (Zv9):
- Chromosome 22 (position 37805680)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 34990560 GRCz11 22 34966309 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGAACCTGAAGAAGCTCAACAGCGGGATGGCGTTTCTCATCAAACACTCA[C/T]AGAAGATCTTTAGGGTATCTTTTCAGATCAAACCTTTTCTCACTGCAGCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
